Open Access

Polymorphisms of VEGF and VEGF receptors are associated with the occurrence of ovarian hyperstimulation syndrome (OHSS)—a retrospective case–control study

  • Kazem Nouri1,
  • Peter Haslinger1,
  • Ladislaus Szabo1,
  • Michael Sator1, 2,
  • Martin Schreiber1,
  • Christian Schneeberger1 and
  • Detlef Pietrowski1Email author
Journal of Ovarian Research20147:54

DOI: 10.1186/1757-2215-7-54

Received: 26 January 2014

Accepted: 5 May 2014

Published: 13 May 2014

Abstract

Background

Ovarian hyperstimulation syndrome (OHSS) is the most serious complication of IVF/ICSI therapy. The pathophysiology and etiology of the disease is still not fully clarified.

Methods

To assess whether polymorphisms of the VEGF/VEGF-receptor system contribute to the occurrence of ovarian hyperstimulation syndrome (OHSS), we performed a retrospective analysis of 116 OHSS patients, and 124 female controls. The following SNPs were genotyped: Rs2071559 (VEGFR2-604); rs2305948 (VEGFR2-1192); rs1870377 (VEGFR2-1719); rs2010963 (VEGF-405); and rs111458691 (VEGFR1-519). Odds ratios (ORs) were estimated with a 95% confidence interval (CI). Linkage disequilibrium (LD) analysis was performed in the three loci of the VEGFR2 gene.

Result

We found an overrepresentation of the T allele of the VEGFR1-519 polymorphism in OHSS patients (P = 0.02, OR: 3.62, CI: 1.16 – 11.27). By genotype modeling, we found that polymorphism of VEGFR1-519 and VEGF-405 showed significant differences in patients and controls (p = 0.02, OR: 3.79 CI: 1.98 – 11.97 and p = 0.000005, OR: 0.29, CI: 0.17 – 0.50). LD analysis revealed significant linkage disequilibrium in VEGFR2.

Conclusion

Polymorphisms in the VEGFR2 gene and in the VEGF gene are associated with the occurrence of OHSS. This strengthens the evidence for an important role of the VEGF/VEGF- receptor system in the occurrence of OHSS.

Keywords

ART IVF-therapy Vascular permeability VEGF OHSS

Introduction

Iatrogenic ovarian hyperstimulation syndrome (OHSS) is the most serious complication of IVF/ICSI therapy. OHSS is characterized by ovarian enlargement and fluid shift from the intravascular to the extravascular compartment[1]. Although the etiology of OHSS is far from being fully understood, there are two frequently observed pathologies: (i) an increase in vascular permeability; and (ii) HCG is the triggering factor for this condition[2, 3].

The mechanism by which HCG triggers vascular permeability in OHSS patients is still under investigation, but the vascular endothelial growth factor (VEGF) and its receptors seem to play a key role in this physiological process[47]. These observations are strengthened by the findings that the probability of developing OHSS correlates with the concentration of VEGF in serum[811] and that, in OHSS patients, the amount of VEGF in the follicular fluid is frequently higher than in individuals not affected by this complication[12]. Interestingly, both the clinical pregnancy rate and abortion rate in OHSS patients were significantly higher than that in patients without the syndrome[13, 14]. These observations suggest that early pregnancy processes, i.e., implantation, trophoblast invasion, or placentation, are also affected in OHSS patients[15].

VEGF triggers its signalling via a set of three main receptors named VEGF receptor 1 to 3 (VEGFR1, VEGFR2, VEGFR3). However, only VEGFR1 and VEGFR2 are shown to be directly involved in VEGF binding[16, 17].

Single nucleotide polymorphisms (SNPs) are described in the VEGF gene, as well as in VEGFR1 and VEGFR2. For some of these, a direct association with the transcriptional activity of the corresponding genes has been shown[1820]. Polymorphisms in the VEGFR2 promoter region have been found to influence the transcription activity of VEGFR2, contributing to the development of coronary artery lesions (CAL) in patients with Kawasaki disease (KD) and various cancers[2123].

In light of recent interest in the interplay between decreased serum concentration of soluble VEGF (sVEGF) receptors and an increased serum concentration of VEGF, our group hypothesized that the development of OHSS is based on the finding that the higher the concentration of VEGF and the lower the concentration of the sVEGF-receptors, the higher the probability of the occurrence of OHSS is[11].

Materials and methods

In this case–control study, we included 116 women who suffered from severe OHSS during their IVF/ICSI therapy, and 124 healthy pregnant women who had delivered children in the department of OB/GYN at the General Hospital of Vienna (AKH). Institutional Review Board approval was obtained for the study at the MUW Ethikkommission (Reg. number 1398/2012).

We included all inpatients with the diagnosis of severe OHSS who required immediate hospitalization. The criteria for admission was met when at least two of the following factors were observed: 1) clinically relevant symptoms, such as diffuse abdominal discomfort, nausea, vomiting, dyspnea and tachypnea, subjective decreased urinary output; 2) electrolyte imbalance, leukocytosis >20,000/mm3, creatinine >1 mg/dL, and hematocrit >45%; and 3) sonographically detectable free fluid (ascites and/or pleural effusion), with a significant increase in ovarian diameter (>12 cm); and 3) clinical signs, such as oliguria <600 mL in 24 hours and hypotension.

Patients received stimulation with recombinant or human menopausal gonadotropins (hMG) after down-regulation via GnRHa (gonadotropin releasing hormone agonist) in case of a long protocol, or using Ganirelix (Orgalutran MSD Pharma) or Cetrorelix (Cetrotide MerckSerono) in case of an antagonist protocol.

All subjects received either 10,000 IU of hCG (Pregnyl, MSD Pharma), Choriogonadotropin alpha 250 μg (Ovitrell MerckSerono), or Triptorelin acetate 0.2 mg (Decapeptyl Ferring Austria) to trigger final oocyte maturation. Patients with any systemic disease were excluded from the study group and the control group. EDTA blood was obtained from all participants by peripheral antecubital vein puncture, and stored at-18°C until the analysis was performed.

Standardized OHSS treatment

Once the patients were hospitalized with the diagnosis of OHSS III-IV according to Golan et al., they all received the same therapeutic protocol. Complete blood count with hematocrit, serum analysis of albumin, blood creatinine, blood urea, and creatinine clearance, liver function parameters, and coagulation tests on a daily basis were obtained in all patients. The amount of excreted urine, fluid balance, body weight, and abdominal circumference were carefully checked every 24 hours.

All patients were treated with 1000 ml lactated Ringer’s solution twice a day, with furosemide 20 mg (Lasix® 20 mg, Sanofi, Vienna, Austria) to maintain the diuresis. Plasma volume expansion with hydroxyethyl starch solution 6% (HAES-steril® 6% Infusionslösung, 250 ml KABI, Bd Homburg Germany), and/or human albumin 25% (Human Albumin® Octapharm, Langfeld, Germany) were given once daily in cases of hypoalbuminemia or right after paracentesis (>34 g/L).

If patients complained of pain or compromised pulmonary function, paracentesis was performed with a transvaginal approach.

Patients had to wear full-length venous support stockings. Prophylactic Enoxaparin therapy of 40 mg on a daily basis (Lovenox 40 mg, Sanofi-Aventis GmbH Vienna) was given to all patients during in-patient treatment. The prophylactic therapy with Cabergoline o.5 (Dostinex®, Pharmacia, Berlin, Germany) was given to all patients from January 2008, orally once a day within eight days after retrieval.

The duration of the hospitalization was dependent on two factors: i) resolution of the symptoms; and ii) normalization of the lab results. Patients were discharged from the hospital when their hematocrit, without receiving any infusions, remained under 40%.

Genotyping

We determined the genotypes of five polymorphisms in three genes by polymerase chain reaction and restriction fragment polymorphism analysis: VEGFR1 (other name FLT1); VEGFR2 (other name KDR); and VEGF. We used the SNP rs111458691 for genotyping the VEGFR1-519 polymorphism, rs2071559, rs2305948, and rs1870377 for genotyping the VEGFR2-604, VEGFR2-1192 and VEGFR2-1719 polymorphisms, respectively, and rs2010963 for genotyping the VEGF-405 polymorphism.

To determine the genotypes, we amplified a genomic DNA fragment by polymerase chain reaction (PCR). PCR amplification was performed with 0.2 mM dNTP, 10 μM forward primer, 10 μM reverse primer, 1.5 mM MgCl2, and 1 U Taq polymerase (Sigma Qiagen, Hilden, Germany) in the recommended buffer. Cycling conditions were: 45 cycles in an Eppendorf Thermocycler at 94°C for 30 s, 60°C to 65°C for 30 s, and 72°C for 45 s after the initial denaturation step (94°C for 5 min). A seven-minute final extension step at 72°C was added. The total volume of the PCR reaction was 25 μl. The size of the PCR products, the enzymes used, and the resulting fragment length are given in Table 1. Fragments were visualized after electrophoresis on a 3%-4% agarose gel by staining with ethidium bromide. Pictures were taken with a Canon digital camera system (UVP Laboratory Products, USA).
Table 1

Primers, fragment length and enzymes used for RFLP analysis

Gene/SNP

Primers (5′-3′)

Fragment lengths (bp)

Enzyme

RefSNP

VEGFR2- 604

Fw: CAAACTTTCACTAGGGCTCTTCGT

290;174;116

Bsm I

2071559

 

Rev: AGCCACAAGGGAGAAGCGGATA

 

VEGFR2-1192

Fw: TGAGGTTAAAAGTTCTGGTGTCCCTGTT

262;232;30

BstZ17 I

2305948

 

Rev: AATGTACAATCCTTGGTCACTCCGGGGTA

 

VEGFR2-1719

Fw: CCTCCTGTATCCTGAATGAATCT

404;191;213

Alu I

1870377

 

Rev: GCCTCACATATTATTGTACCATCC

 

VEGF-405

Fw: ATTTATTTTTGCTTGCCATT

304;191;213

BsmF 1

2010963

 

Rev: GTCTGTCTGTCTGTCCGTCA

 

VEGFR1-519

Fw: GTGGCAACTTTGGGTTACCCA

665;520;145

Nsp I

111458691

 

Rev: CCTGACCCCTTCAGACTGTCC

 

Statistical analysis

Statistical analyses were performed using a chi-square test of association and a Fisher’s exact probability test at the Vassar Stats homepage (http://vassarstats.net/). A value of P < 0.05 was defined as statistically significant. Odds ratios, confidence intervals, and linkage disequilibrium analyses were performed with R, an open-source language and environment for statistical computing[24]. To adjust the values for multiple comparisons, we used the Benjamini-Hochberg correction method, which controls for false discovery rate (FDR)[25].

Results

Blood samples from 240 subjects (116 patients and 124 controls) were analyzed. An overrepresentation of the T allele of the VEGFR1-519 C > T polymorphism (rs111458691) was found in OHSS patients. The significant difference in the allele frequencies resulted in a 3.6-fold overrepresentation (p = 0.018), OR:3.62; CI: 1.16 – 11.27)). Although it did not reach a level of significance, a tendency toward overrepresentation of the A Allele of VEGFR2-1192 (rs2305948) in OHSS patients was also found (p = 0.06, OR:1.76; CI: 0.97 – 3.18). The allele frequencies of VEGFR2-604 (rs2071559), VEGFR2-1719 (rs1870377), and VEGFA-405 (rs2010963) were not statistically different (Table 2).
Table 2

Allele frequencies

  

OHSS (%)

Control (%)

P-valuea

Chi

OR (CI)

VEGFR1-519

      
 

C

219 (94.40)

244 (98.39)

   
 

T

13 (5.60)

4 (1.61)

0.018*

5.59

3.62 (1.16 - 11.27)

VEGFR2-604

      
 

T

107 (46.12)

125 (50.40)

   
 

C

125 (53.88)

123 (49.60)

0.35

0.88

1.19 (0.83- 1.7)

VEGFR2-1192

      
 

G

201 (86.64)

228 (91.94)

   
 

A

31 (13.36)

20 (8.06)

0.06

5.59

1.76 (0.97 - 3.18)

VEGFR2-1719

      
 

T

55 (23.71)

60 (24.19)

   
 

A

177 (67.29)

188 (75.81)

0.88

0.02

0.97 (0.64 - 1.48)

VEGF-405

      
 

G

91 (39.22)

108 (43.55)

   
 

A

141 (60.78)

140 (5645)

0.34

0.92

0.84 (0.58 - 1.20)

aChi square test was used, with p < 0.05 considered significant and marked with an asterisk. To adjust the values for multiple comparisons, we used the Benjamini-Hochberg (BH) correction method, which controls false discovery rate (FDR).

We calculated different genotype models and considered the model with the smallest probability value as the best–fitting model for the respective genotype. Using an overdominant genotype model, we found that VEGF-405 polymorphism is significantly associated with OHSS (p = 0.000005; OR:0.29; CI: (0.17 – 0.50), and we found a significant association of VEGFR1-519 SNP with OHSS (p = 0.014; OR: 3.79; CI: 1.2 – 11.97), using a co-dominant genotype model.

No significant difference in genotype distribution models was found for VEGFR2-604, VEGFR2-1192, and VEGFR2-1719 (Table 3).
Table 3

Genotypes

 

Control

%

Patient

%

OR

Lower

Upper

p-valuea

VEGFR1-519

        

(Co-dominant)

C/C

120

96,8

103

88,8

1,00

-

-

0,01*

C/T

4

3,2

13

11,2

3,79

1,20

11,97

 

T/T

0

-

0

-

-

-

-

 

VEGFR2-604

        

(Co-dominant)

C/C

22

17,7

28

24,1

1

-

-

0,47

C/T

79

63,7

69

59,5

0,69

0,36

1,31

 

T/T

23

18,5

19

16,4

0,65

0,28

1,48

 

VEGFR2-1192

        

(Co-dominant)

G/G

106

85,5

90

77,6

1

-

-

0,22

G/A

16

12,9

21

18,1

1,55

0,76

3,14

 

A/A

2

1,6

5

4,3

2,94

0,56

15,54

 

VEGFR2-1719

        

(Co-dominant)

A/A

69

55,6

66

56,9

1

-

-

0,97

A/T

50

40,3

45

38,8

0,94

0,56

1,59

 

T/T

5

4,0

5

4,3

1,05

0,29

3,78

 

VEGF-405

        

(Recessive)

A/A-A/G

116

93,5

97

83,6

1

-

-

0,01*

G/G

8

6,5

19

16,4

2,84

1,19

6,77

 

aChi square test was used, with p < 0.05 considered significant and marked with an asterisk.

The data from the three SNPs of VEGFR2 were tested for redundancy by linkage disequilibrium (LD) analyses. This analysis showed a significant LD for SNP VEGFR2-604 vs. VEGFR2-1192 (D’ = 0,44; r = -0.15; p = 0.001) and for VEGFR2-1192 vs. VEGFR2-1719 (D’ = 0.31; r = 0.19; p = 0.00003). However, this did not reveal a significant correlation between VEGFR2-604 and VEGFR2-1719.

Since we followed a standardized therapy for all our patients, we defined the day of discharge from the hospital as the day when the symptoms of OHSS were resolved. In Table 4, we examined the correlation between the duration of the hospitalization between the patients with and without the investigated polymorphisms. Therefore, we grouped patients into two groups with regard to their stay in our clinic (Group 1: one to nine days; group 2: 10 to 28 days; mean of all samples: 10.03 days). This subgroup analysis showed no statistically significant difference between patients who stayed longer than nine days in the hospital and patients who stayed between one and nine days in our clinic for every analyzed SNP.
Table 4

Subgroup analysis

Allele frequencies in accordance to hospital stay

  

OHSS-S (%)

OHSS-L (%)

P-value

Chi

OR (CI)

Mean (Range)

 

6.58 (2–9)

13.36 (10 – 28)

   

VEGFR1-519

C

107 (93.9%)

112 (94.9%)

   
 

T

7 (6.1%)

6 (5.1%)

0.78

0.73

1.22 (0.39 - 3.75)

VEGFR2-604

T

56 (49.1%)

51 (43.2%)

   
 

C

58 (51.9%)

67 (56.8%)

0.79

0.78

0.93 (0.55 - 1.57)

VEGFR2-1192

G

99 (86.8%)

102 (86.4%)

   
 

A

15 (13.2%)

16 (13.6%)

1.0

0.92

0.97 (0.45 - 2.1)

VEGFr2-1719

T

25 (21.9%)

30 (25.4%)

   
 

A

89 (78.1%)

88 (74.6%)

0.54

0.53

1.22 (0.66 - 2.23)

VEGF-405

G

42 (36.8%)

49 (41.5%)

   
 

A

72 (63.2%)

69 (58.5%)

0.50

0.47

1.22 (0.72 - 2.06)

Legend: Allel frequencies and p values are given for association of SNPs and duration time in hospital. OHSS-S: Duration in hospital 1–9 days, OHSS-L: Duration in hospital 10–28 days.

Discussion

In this study, we investigated the association of five polymorphisms in three genes of the VEGF/VEGF receptor system and the occurrence of OHSS in 116 patients who suffered from OHSS and 124 healthy pregnant women. We analyzed a more general group of patients as controls, namely, healthy pregnant women, because this group represents a cross-sectional control compared to IVF patients, and is not selected by various fertility-related pathologies that are characteristic of IVF patients.

We found a significant association of the VEGF405 polymorphism (rs2010963) and the VEGFR1-519 polymorphism (rs111458691) with the occurrence of OHSS. However, the absolute difference of 5.6% and 1.6% in VEGFR1-519 T SNP for patients with OHSS shows that this SNP seems to be a rather rare allele.

The finding of a statistically significant association of the VEGF-405 SNP and OHSS development confirms and extends previous findings by Hanevik et al., who demonstrated an association of this SNP and OHSS in a study group of 53 Norwegian patients suffering from OHSS and a control group that performed IVF therapy but did not suffer from this complication[26]. Our collective comprised 116 OHSS patients with a presumably different Caucasian ethnicity than in Hanevik’s study, and were compared to healthy pregnant women. Although our findings might strengthen the validity of a correlation between OHSS and the VEGF-405 genotype, these findings also open the possibility of a correlation between other fertility-related pathologies (e.g., PCOS, endometriosis) with this SNP that require IVF therapy. In both cases, this genotype variation might be of biological significance because it has been shown by other authors that this genotype contributes to VEGF serum levels[20] and that VEGF serum levels are associated with OHSS, PCOS, and endometriosis[2729]. In addition, Watson et al. identified a predicted myeloid zinc finger binding site (MZF1) at polymorphism VEGF-405 that opens the possibility that variations at this site directly affect VEGF gene expression through a different binding efficiency of zinc finger transcription factors at its recognition site[18].

To the best of our knowledge, we show, for the first time, an association between the VEGF-receptor polymorphism VEGFR1-519 (rs111458691) and the occurrence of OHSS.

Previously, polymorphisms in the VEGF receptors were shown to be associated with some common cancers, stroke, systemic lupus erythematosus, and recurrent pregnancy loss[23, 3033]. Moreover, in colon and rectal cancer, it was suggested that the VEGF receptors have a greater influence on cancer risk than VEGF, and it is thought that this effect might be caused by an interaction of the VEGF receptors with inflammatory signals[23].

An analysis of the VEGFR1-519 SNP by Menendez et al. demonstrated that the T-allele generates a p53 response element, placing the VEGF-VEGF receptor system directly in the p53 stress response transcriptional network[34]. In our study, we found an overrepresentation of the T-allele in OHSS patients. This opens the intriguing possibility that p53-mediated stress signalling indirectly contributes to the pathology of OHSS, and led us to suggest a role for p53 in the pathology of OHSS. This idea is strengthened by the recent findings of Boudjenah et al., showing that p53 polymorphisms could influence the ovarian response to rFSH stimulation for patients undergoing an intracytoplasmic sperm injection program[35]. In a subgroup analysis of the OHSS patient group, we correlated the hospital stay with the various SNPs. This analysis revealed no significant differences in allele frequencies between patients who have a short stay in the hospital (one-to-nine days) and patients who required a longer habitation (10–28 days). This finding suggests that the severity of OHSS based on hospital stay is not associated with any of the analyzed polymorphisms.

Our study has some limitations. This is a retrospective study and some data, such as full infertility anamnesis, possible medication effects, and the exact IVF protocol—including E2 concentration on the day of retrieval—are missing because patients were included from other clinics after their OHSS symptoms required medical care in a specialized center. In addition, we found that the polymorphism VEGF-405 is out of the Hardy Weinberg equilibrium (HWE). Based on the small amount of possible further information available about our study population, a selection bias could not be excluded.

Conclusion

In the present study, we found a significant association of the VEGF405 polymorphism (rs2010963) and the VEGFR1-519 polymorphism (rs111458691) with the occurrence of OHSS. The identification of a context between OHSS and specific gene variants of the VEGF/VEGF receptor system involved in vascular permeability enabled further insights concerning the pathophysiology and etiology of OHSS, and may contribute to a genetic characterization of susceptible women before beginning an ART program. Although the present study may provide informative and supportive data relating to the clinical significance of OHSS and its relationship to the VEGF/VEGF-receptor system, future larger studies should be performed to fully explore this putative gene–epidemiology interaction.

Declarations

Acknowledgment

We thank our patients and gratefully acknowledge the help of the members of the IVF Unit and the nurses in the patient care unit at the Women’s Hospital in Vienna.

Authors’ Affiliations

(1)
Department of Endocrinology and Reproductive Medicine, Medical University Vienna
(2)
Privatklinik Doebling, Fertility Center Doebling

References

  1. Golan A, Ron-el R, Herman A, Soffer Y, Weinraub Z, Caspi E: Ovarian hyperstimulation syndrome: an update review. Obstet Gynecol Surv 1989,44(6):430–440. 10.1097/00006254-198906000-00004View ArticlePubMedGoogle Scholar
  2. Soares SR, Troncoso C, Bosch E, Serra V, Simon C, Remohi J, Pellicer A: Age and uterine receptiveness: predicting the outcome of oocyte donation cycles. J Clin Endocrinol Metab 2005,90(7):4399–4404. 10.1210/jc.2004-2252View ArticlePubMedGoogle Scholar
  3. Orvieto R: Can we eliminate severe ovarian hyperstimulation syndrome? Hum Reprod 2005,20(2):320–322.View ArticlePubMedGoogle Scholar
  4. Herr D, Sallmann A, Bekes I, Konrad R, Holzheu I, Kreienberg R, Wulff C: VEGF induces ascites in ovarian cancer patients via increasing peritoneal permeability by downregulation of Claudin 5. Gynecol Oncol 2012,127(1):210–216. 10.1016/j.ygyno.2012.05.002View ArticlePubMedGoogle Scholar
  5. Pietrowski D, Keck C: Differential regulation of ANG2 and VEGF-A in human granulosa lutein cells by choriogonadotropin. Exp Clin Endocrinol Diabetes 2004,112(4):208–214.View ArticlePubMedGoogle Scholar
  6. Walz A, Keck C, Weber H, Kissel C, Pietrowski D: Effects of luteinizing hormone and human chorionic gonadotropin on corpus luteum cells in a spheroid cell culture system. Mol Reprod Dev 2005,72(1):98–104. 10.1002/mrd.20325View ArticlePubMedGoogle Scholar
  7. Kasum M: New insights in mechanisms for development of ovarian hyperstimulation syndrome. Coll Antropol 2010,34(3):1139–1143.PubMedGoogle Scholar
  8. Abramov Y, Barak V, Nisman B, Schenker JG: Vascular endothelial growth factor plasma levels correlate to the clinical picture in severe ovarian hyperstimulation syndrome. Fertil Steril 1997,67(2):261–265. 10.1016/S0015-0282(97)81908-5View ArticlePubMedGoogle Scholar
  9. Artini PG, Fasciani A, Monti M, Luisi S, D'Ambrogio G, Genazzani AR: Changes in vascular endothelial growth factor levels and the risk of ovarian hyperstimulation syndrome in women enrolled in an in vitro fertilization program. Fertil Steril 1998,70(3):560–564. 10.1016/S0015-0282(98)00221-0View ArticlePubMedGoogle Scholar
  10. Agrawal R, Conway GS, Engmann L, Bekir JS, Jacobs HS, Sladkevicius P, Bekir J, Campbell S, Tan SL, Hoveyda F, Steele J, Lopez Bernal A, Barlow DH, Siano L, Schmidt D, Nulsen J, Maier D, Benadiva C: The pattern of changes in ovarian stromal and uterine artery blood flow velocities during in vitro fertilization treatment and its relationship with outcome of the cycle. Gynecol Endocrinol 1999,13(1):26–33. 10.1080/09513599909167528View ArticleGoogle Scholar
  11. Pietrowski D, Szabo L, Sator M, Just A, Egarter C: Ovarian hyperstimulation syndrome is correlated with a reduction of soluble VEGF receptor protein level and a higher amount of VEGF-A. Hum Reprod 2012,27(1):196–199. 10.1093/humrep/der349View ArticlePubMedGoogle Scholar
  12. Wang TH, Horng SG, Chang CL, Wu HM, Tsai YJ, Wang HS, Soong YK: Human chorionic gonadotropin-induced ovarian hyperstimulation syndrome is associated with up-regulation of vascular endothelial growth factor. J Clin Endocrinol Metab 2002,87(7):3300–3308. 10.1210/jcem.87.7.8651View ArticlePubMedGoogle Scholar
  13. Raziel A, Friedler S, Schachter M, Strassburger D, Mordechai E, Ron-El R: Increased early pregnancy loss in IVF patients with severe ovarian hyperstimulation syndrome. Hum Reprod 2002,17(1):107–110. 10.1093/humrep/17.1.107View ArticlePubMedGoogle Scholar
  14. Shi W, Zhang S, Zhao W, Xia X, Wang M, Wang H, Bai H, Shi J: Factors related to clinical pregnancy after vitrified-warmed embryo transfer: a retrospective and multivariate logistic regression analysis of 2313 transfer cycles. Hum Reprod 2013,28(7):1768–1775. 10.1093/humrep/det094View ArticlePubMedGoogle Scholar
  15. Griesinger G, Diedrich K, Devroey P, Kolibianakis EM: GnRH agonist for triggering final oocyte maturation in the GnRH antagonist ovarian hyperstimulation protocol: a systematic review and meta-analysis. Hum Reprod Update 2006,12(2):159–168.View ArticlePubMedGoogle Scholar
  16. Neufeld G, Cohen T, Gengrinovitch S, Poltorak Z: Vascular endothelial growth factor (VEGF) and its receptors. FASEB J 1999,13(1):9–22.PubMedGoogle Scholar
  17. Ferrara N: Vascular endothelial growth factor: basic science and clinical progress. Endocr Rev 2004,25(4):581–611. 10.1210/er.2003-0027View ArticlePubMedGoogle Scholar
  18. Watson CJ, Webb NJ, Bottomley MJ, Brenchley PE: Identification of polymorphisms within the vascular endothelial growth factor (VEGF) gene: correlation with variation in VEGF protein production. Cytokine 2000,12(8):1232–1235. 10.1006/cyto.2000.0692View ArticlePubMedGoogle Scholar
  19. Awata T, Inoue K, Kurihara S, Ohkubo T, Watanabe M, Inukai K, Inoue I, Katayama S: A common polymorphism in the 5′-untranslated region of the VEGF gene is associated with diabetic retinopathy in type 2 diabetes. Diabetes 2002,51(5):1635–1639. 10.2337/diabetes.51.5.1635View ArticlePubMedGoogle Scholar
  20. Steffensen KD, Waldstrom M, Brandslund I, Jakobsen A: The relationship of VEGF polymorphisms with serum VEGF levels and progression-free survival in patients with epithelial ovarian cancer. Gynecol Oncol 2010,117(1):109–116. 10.1016/j.ygyno.2009.11.011View ArticlePubMedGoogle Scholar
  21. Wang Y, Zheng Y, Zhang W, Yu H, Lou K, Zhang Y, Qin Q, Zhao B, Yang Y, Hui R: Polymorphisms of KDR gene are associated with coronary heart disease. J Am Coll Cardiol 2007,50(8):760–767. 10.1016/j.jacc.2007.04.074View ArticlePubMedGoogle Scholar
  22. Kariyazono H, Ohno T, Khajoee V, Ihara K, Kusuhara K, Kinukawa N, Mizuno Y, Hara T: Association of vascular endothelial growth factor (VEGF) and VEGF receptor gene polymorphisms with coronary artery lesions of Kawasaki disease. Pediatr Res 2004,56(6):953–959. 10.1203/01.PDR.0000145280.26284.B9View ArticlePubMedGoogle Scholar
  23. Slattery ML, Lundgreen A, Wolff RK: VEGFA, FLT1, KDR and colorectal cancer: assessment of disease risk, tumor molecular phenotype, and survival. Mol Carcinog 2014, 53 Suppl 1: E140–150.View ArticlePubMedGoogle Scholar
  24. Development Core Team R: R: A language and environment for statistical computing 2009. Vienna, Austria: R Foundation for Statistical Computing; 2009.Google Scholar
  25. Benjamini Y, Hochberg Y: Controlling the false discovery rate - a practical and powerful approach to multiple testing. J R Stat Soc B Methodological 1995,57(1):289–300.Google Scholar
  26. Hanevik HI, Hilmarsen HT, Skjelbred CF, Tanbo T, Kahn JA: Increased risk of ovarian hyperstimulation syndrome following controlled ovarian hyperstimulation in patients with vascular endothelial growth factor +405 cc genotype. Gynecol Endocrinol 2012,28(11):845–849. 10.3109/09513590.2012.683056View ArticlePubMedGoogle Scholar
  27. Peitsidis P, Agrawal R: Role of vascular endothelial growth factor in women with PCO and PCOS: a systematic review. Reprod Biomed Online 2010,20(4):444–452. 10.1016/j.rbmo.2010.01.007View ArticlePubMedGoogle Scholar
  28. Li YZ, Wang LJ, Li X, Li SL, Wang JL, Wu ZH, Gong L, Zhang XD: Vascular endothelial growth factor gene polymorphisms contribute to the risk of endometriosis: an updated systematic review and meta-analysis of 14 case–control studies. Genet Mol Res 2013,12(2):1035–1044. 10.4238/2013.April.2.20View ArticlePubMedGoogle Scholar
  29. Kianpour M, Nematbakhsh M, Ahmadi SM, Jafarzadeh M, Hajjarian M, Pezeshki Z, Safari T, Eshraghi-Jazi F: Serum and peritoneal fluid levels of vascular endothelial growth factor in women with endometriosis. Int J Fertil Steril 2013,7(2):96–99.PubMed CentralPubMedGoogle Scholar
  30. Scartozzi M, Bianconi M, Faloppi L, Loretelli C, Bittoni A, Del Prete M, Giampieri R, Maccaroni E, Nicoletti S, Burattini L, Minardi D, Muzzonigro G, Montironi R, Cascinu S: VEGF and VEGFR polymorphisms affect clinical outcome in advanced renal cell carcinoma patients receiving first-line sunitinib. Br J Cancer 2013,108(5):1126–1132. 10.1038/bjc.2012.501PubMed CentralPubMedGoogle Scholar
  31. Shibuya M: Vascular endothelial growth factor and its receptor system: physiological functions in angiogenesis and pathological roles in various diseases. J Biochem 2013,153(1):13–19. 10.1093/jb/mvs136PubMed CentralView ArticlePubMedGoogle Scholar
  32. Su MT, Lin SH, Lee IW, Chen YC, Hsu CC, Pan HA, Kuo PL: Polymorphisms of endocrine gland-derived vascular endothelial growth factor gene and its receptor genes are associated with recurrent pregnancy loss. Hum Reprod 2010,25(11):2923–2930. 10.1093/humrep/deq256View ArticlePubMedGoogle Scholar
  33. Su MT, Lin SH, Lee IW, Chen YC, Kuo PL: Association of polymorphisms/haplotypes of the genes encoding vascular endothelial growth factor and its KDR receptor with recurrent pregnancy loss. Hum Reprod 2011,26(4):758–764. 10.1093/humrep/deq401View ArticlePubMedGoogle Scholar
  34. Menendez D, Krysiak O, Inga A, Krysiak B, Resnick MA, Schonfelder G: A SNP in the flt-1 promoter integrates the VEGF system into the p53 transcriptional network. Proc Natl Acad Sci U S A 2006,103(5):1406–1411. 10.1073/pnas.0508103103PubMed CentralView ArticlePubMedGoogle Scholar
  35. Boudjenah R, Molina-Gomes D, Torre A, Bergere M, Bailly M, Boitrelle F, Taieb S, Wainer R, Benahmed M, de Mazancourt P, Selva J, Vialard F: Genetic polymorphisms influence the ovarian response to rFSH stimulation in patients undergoing in vitro fertilization programs with ICSI. PLoS One 2012,7(6):e38700. 10.1371/journal.pone.0038700PubMed CentralView ArticlePubMedGoogle Scholar

Copyright

© Nouri et al.; licensee BioMed Central Ltd. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement