Skip to main content

Table 1 Sequences of oligonucleotides for real time PCR

From: Hematopoietic-Prostaglandin D2 synthase through PGD2 production is involved in the adult ovarian physiology

Primers Sequence 5'-3' Primers Sequence 5'-3'
mFSHRfwd gtgcgggctactgctacact mGapdhFwd tggcaaagtggagattgttgcc
mFSHRrev caggcaatcttacggtctcg mGapdhRev aagatggtgatgggcttcccg
mLHRqFwd gatgcacagtggcaccttc mP27Fwd gagcagtgtccagggatgag
mLHRqRev cctgcaatttggtggaagag mP27Rev tctgttctgttggccctttt
mStARqFwd ttgggcatactcaacaacca mCycD2Fwd ctgtgcatttacaccgacaac
mStARqRev acttcgtccccgttctcc mCycD2Rev cactaccagttcccactccag
mSCCqFwd aagtatggccccatttacagg mCox-1Fwd cctctttccaggagctcaca
mSCCqRev tggggtccacgatgtaaact mCox-1Rev tcgatgtcaccgtacagctc
mDP1Fwd cccagtcaggctcagactaca mCox-2Fwd gctcttccgagctgtgct
mDP1Rev aagtttaaaggctccatagtacgc mCox-2Rev cggttttgacatggattgg
mDP2Fwd catcgtggttgccttcgt mPges-2Fwd cccaggaaggagacagctt
mDP2Rev gcctccagcagactgaagat mPges-2Rev aggtaggtcttgagggcactaat
mSF-1Fwd cacgaaggtgcatggtctt mHPgdsFwd cacgctggatgacttcatgt
mSF-1Rev cagttctgcagcagtgtcatc mHpgdsRev aattcattgaacatccgctctt
mCYP19Fwd cctcgggctacgtggatg mLPgdsFwd ggctcctggacactacacct
mCYP19Rev gagagcttgccaggcgttaaa mLPgdsRev atagttggcctccaccactg
mEP2Fwd tgctccttgcctttcacaat mFPFwd ctggccataatgtgcgtct
mEP2Rev ctcggaggtcccacttttc mFPRev tgcaatgttggccattgtta
hGapdhFwd gagaaggctggggctcat hHPgdsFwd gagaatggcttattggtaactctgt
hGapdhRev tgctgatgatcttgaggctg hHPgdsRev aaagaccaaaagtgtggtactgc