Skip to main content

Table 3 Primers used for RT- PCR and Q-PCR

From: Gonadotropin treatment augments postnatal oogenesis and primordial follicle assembly in adult mouse ovaries?

Gene Primer Annealing Temp (° C)
Fshr F: TGGAGGCGGCAAACCTCTGAAC 65
R: TCTGGCTTTGGCGAGCAGGTC
Oct-4A F: CCATGTCCGCCCGCATACGA 61
R: GGGCTTTCATGTCCTGGGACTCCT
Total F: CCTGGGCGTTCTCTTTGGAAAGGTG 68
Oct-4 R: GCCTGCACCAGGGTCTCCGA
Nanog [34] F: CAGGAGTTTGAGGGTAGCTC 61
R: CGGTTCATCATGGTACAGTC
Stella F: ACGCTTTGGATGATACAGACGTCC 67
R: GCGCTTTGAACTTCCCTCCGGA
Fragilis F: GGGGTGACTGAGCTGGGGGAA 65
R: TGTCCCTAGACTTCACAGAGTAGGC
Nobox F: AGGGTGCTGAGAGGGTGGCAG 66
R: GGCGATACTAGTGCCCCAGGAC
HoxA10 F:CACTTGTCCGGCACCCCTTCG 65
R: TTCGCCTTTGGAACTGCCTTGAC
Mvh F: AGTGGAAGTGGTCGAGGTGGT 61
R: TGCCGGTGGTGCATCATGTCC
Scp3 F: TGTTGCAGCAGTGGGAACTGGAT 68
R: CCATCTCTTGCTGCTGAGTTTCCA
Dmc-1 F: TGGGGAATTGGCTGAACGCC 68
R: CAGGCATCTCGGGGCTGTCATAA
Stra8 F: GTTTCCTGCGTGTTCCACAAG 61
R: CACCCGAGGCTCAAGCTTC
18s F:GGAGAGGGAGCCTGAGAAAC 61
R: CCTCCAATGGATCCTCGTTA
Gapdh [34] F: GTCCCGTAGACAAAATGGTGA 58
  R: TGCATTGCTGACAATCTTGAG