Skip to main content

Table 1 Primers list

From: The mechanism of mTOR (mammalian target of rapamycin) in a mouse model of polycystic ovary syndrome (PCOS)

mTOR 150 bp forward, TTG GAG TGG CTG GGT GCT GA
reverse, AAG GGC TGA ACT TGC TGG AA
Raptor 148 bp forward, GCC ATC ACAGAT ACC ATC GC
reverse, CTG CTT ACT GGGGTG CAG TT
Rictor 110 bp forward, GAG AAC GTC CCG CTC GAT CT
reverse, TGG CCCAGC TTT CTC ATA TT
LST8 (GβL) 138 bp forward, GAC TAA GGC AGA GTG CAG AG
reverse, AAA AGC GCA CCG TGT GGT CA
P70S6K 300 bp forward, CTTGGCGAAT TAAGGGCTGC
reverse, GCATAGGCCAGTTCTACAAT
PKCalpha 300 bp forward, GTCCTGCACCGGTTGGCGAA
reverse, GACCCACAGTGATCACAGAA
β-actin 399 bp forward, GAT GAC GAT ATC GCT GCG CTG
reverse, GTA CGA CCA GAG GCA TAC AGG