Skip to main content

Table 1 Primer details and cycling conditions used in the study

From: Follicle stimulating hormone modulates ovarian stem cells through alternately spliced receptor variant FSH-R3

  Sequence Annealing temperature Amplicon size
  FSH Receptor Transcripts   
R1 CATTCACTGCCCACAACTTTCATC 60°C 84 bp
TGAGTGTGTAATTGGAACCATTGGT
R3 TCTCCACTGCTGCACTGTTGGGCT 55°C 382 bp
ATTCAAATACAGGAAATAGAGAAA
  Pluripotent Stem Cell Marker (VSELs)   
Oct-4A CAATTTGCCAAGCTCCTAAA 53°C 290 bp
TTGCCTCTCACTTGGTTCTC
Sox-2 TGATACGGTAGGAGCTTTGC 56°C 362 bp
CTTTTGCCCCTTTAGAGACC
  Differentiation Marker (OGSCs)   
Oct - 4 (all isoforms) GAGCCGAACCCTGAGGAGTCCC 66°C 225 bp
CAGCAGGGGCCGCAGCTTAC
  Housekeeping Gene   
Gapdh GCC CAG AAC ATC ATC CCT G 60°C 232 bp
GGT CCT CAG TGT AGC CTA G
  1. Oct-4A is a true marker for pluripotent stem cells [33]. Oct-4 primers amplify both Oct-4A and other isoforms including Oct-4B. Oct-4A reflects VSELs whereas several fold increase in Oct-4 reflects increase in the number of OGSCs suggesting differentiation.