Skip to main content

Table 2 PCR primers used for SNP analysis

From: Icb-1 gene polymorphism rs1467465 is associated with susceptibility to ovarian cancer

Polymorphism Primer Sequence
rs1467465 IP1 GCAGACGTCATGTAGCATCTGGCCCA
IP2 GAAAGAGGACTTCCATTGCGTTCCCCAAC
OP1 AGGGAGCTGTGCCGCACACTCTGTAAAG
OP2 GGAGACAGGGTGTTCCTGGGATTTTCCA
rs12048235 IP1 GAAGTCTAGTGTGTCTGTCAGGGAATTTG
IP2 ACCAGAGACACAGAGAATGGAAGAGGTAT
OP1 GGAGGAAAGGCTAAGATGGCAGTTAG
OP2 ATGACAGATTTGCATCTGGACATCTG