Skip to main content

Table 1 Primers, fragment length and enzymes used for RFLP analysis

From: Polymorphisms of VEGF and VEGF receptors are associated with the occurrence of ovarian hyperstimulation syndrome (OHSS)—a retrospective case–control study

Gene/SNP Primers (5′-3′) Fragment lengths (bp) Enzyme RefSNP
VEGFR2- 604 Fw: CAAACTTTCACTAGGGCTCTTCGT 290;174;116 Bsm I 2071559
  Rev: AGCCACAAGGGAGAAGCGGATA  
VEGFR2-1192 Fw: TGAGGTTAAAAGTTCTGGTGTCCCTGTT 262;232;30 BstZ17 I 2305948
  Rev: AATGTACAATCCTTGGTCACTCCGGGGTA  
VEGFR2-1719 Fw: CCTCCTGTATCCTGAATGAATCT 404;191;213 Alu I 1870377
  Rev: GCCTCACATATTATTGTACCATCC  
VEGF-405 Fw: ATTTATTTTTGCTTGCCATT 304;191;213 BsmF 1 2010963
  Rev: GTCTGTCTGTCTGTCCGTCA  
VEGFR1-519 Fw: GTGGCAACTTTGGGTTACCCA 665;520;145 Nsp I 111458691
  Rev: CCTGACCCCTTCAGACTGTCC