Skip to main content

Table 1 List of primers used in the qPCR reactions

From: Expression and molecular consequences of inhibition of estrogen receptors in granulosa cells of bovine follicles

Gene name Primer sequence (5’ to 3’) Reference or accession no.
CYP19A1 F: GTGTCCGAAGTTGTGCCTATT [21]
  R: GGAACCTGCAGTGGGAAATGA  
ESR1 F: CCAACCAGTGCACGATTGAT NM_001001443.1
  R: TTCCGTATTCCGCCTTTCAT  
ESR2 F: CAGCCGTCAGTTCTGTATGCA NM_174051.3
  R: TCCTTTTCAATGTCTCCCTGTTC  
FSHR F: AGCCCCTTGTCACAACTCTATGTC [21]
  R: GTTCCTCACCGTGAGGTAGATGT  
GJA1 F: GTCTTCGAGGTGGCCTTCTTG NM_174068.2
  R: AGTCCACCTGATGTGGGCAG  
LHCGR F: GCACAGCAAGGAGACCAAATAA NM_174381.1
  R: TTGGGTAAGCAGAAACCATAGTCA  
LRP11 F: CCAGAAAGTCGCATTGATCTTG NM_001206831.1
  R: TGTTCCCCTCCTCCTCGATT  
MRO F: CCCACTTACAGGACAGGAATCC NM_001034552.1
  R: TGGAAGCTGTAGTCCTTGCTTTG  
PRKAR2B F: GGGCATTCAACGCTCCAGTA NM_174649.2
  R: CTGGATTCAGCATCATCTTCTTCTT  
  1. F, Forward primers; R, Reverse primers.