Skip to main content

Table 2 Real-time PCR primer sequences

From: Anti Müllerian Hormone (AMH) level and expression in mural and cumulus cells in relation to age

Gene Primer sequences Product length Acce No.
AMH Sense 5’- GCTGCCTTGCCCTCTCTAC 117 NM_000479.3
Antisense, 5’- GAACCTCAGCGAGGGTGTT
β-actin Sense, 5’- CCTGGACTTCGAGCAAGAGA 117 NM_001101.3
Antisense, 5’- CAGCGGAACCGCTCATTGCCAATGG