Skip to main content

Table 1 Gene specific primers used for validation of differentially expressed genes

From: Polycystic ovarian syndrome is accompanied by repression of gene signatures associated with biosynthesis and metabolism of steroids, cholesterol and lipids

Gene bank acc. No Gene symbol Primer 5’ to 3’ bp
NM_012536 CTRB1 F: CTGAAGATCGCACAGGTCTTT 185
R: TCTTGAGGGCATTGTATTTGG
NM_017239 MYH6 F: AAGCTGCAGTTGAAGGTGAAG 214
R: TGGACAGGTTATTCCTCATCG
NM_013085 PLAU F: GAGGGTGCTTGTCCAATATGA 189
R: CAGGAATACACCAGCTTTGCT
NM_207602 ST3GAL6 F: TGCGTATCACAATCTGACTGC 200
R: AATCACCAGGCAGCAACAG
NM_017128 INHBA F: TAGGCAGTCTGAAGACCATCC 199
R: TGAGTGGAAGGAGAGTGAGGA
NM_031558 STAR F: CTCACGTGGCTGCTCAGTAT 221
R: CTTGGCTGAAGGTGAACAGA
NM_017235 HSD17B7 F: CTTTTAGTCCCAGCGAGGAG 188
R: TGGCCCAAACACAAACATAC
NM_138504 OSGIN1 F: CAATCCCTGAGGAGGAAGAG 217
R: CCCCTCTGGTCTATGGCTAC
NM_013413 RLN1 F: CGTTCCCAGAGCTACAACAAC 249
R:CCATTAGCTCCGTATCAGCAG
NM_031144 ACTB F: ACTGGGACGATATGGAGAAGA 202
R:AGAGGCATACAGGGACAACAC
  1. (bp = number of base pairs).