Skip to main content

Table 1 Primers used for real-time RT PCR

From: Changes in gene expression of histone modification enzymes in rat granulosa cells undergoing luteinization during ovulation

Gene   Primer (5' to 3') Amplification size (bp)
EZH2 Forward GCTCTTTTGTCGACGATGTTT 63
Reverse TTGGGTGTTGCATGAAAGG
SETDB2 Forward GCAACACCAAAAGATGGAAGA 65
Reverse CATCTTGTAGCTCCATCCAGAA
HDAC10 Forward CGATGTGTAGCCCATAGAGGT 93
Reverse CCACAGAATTCTCCCATTGC
HDAC4 Forward CACACCTCTTGGAGGGTACAA 68
Reverse AGCCCATCAGCTGTTTTGTC
CIITA Forward TCCTTCCAGCATTCTCTTCC 65
Reverse CCCGATCTTGTTCTCGCTAA
NCOA7 Forward CCACCAAGAGCTGGGAGAT 76
Reverse TCCTCCTCATAGTAGCTGCAAGT
HP1BP3 Forward TGAAGGGGAAGAAGAAAAACC 93
Reverse GGAGCAGGTGGAGTCTCATT
STAR Forward GAAAGCCAGCAGGAGAATGG 78
Reverse CACCTCCAGTCGGAACACCTT
GAPDH Forward CTCATGACCACAGTCCATGC 155
Reverse TTCAGCTCTGGGATGACCTT