Skip to main content

Table 1 Oligonucleotide sequences used for Q-PCR analysis

From: Analysis of MDR genes expression and cross-resistance in eight drug resistant ovarian cancer cell lines

Transcript Sequence (5’-3’ direction) ENST number http://www.ensembl.org Product size (bp)
ABCB1 TGACAGCTACAGCACGGAAG 00000265724 131 bp
TCTTCACCTCCAGGCTCAGT
ABCC1 GAGAGTTCCAAGGTGGATGC 00000399410 149 bp
AGGGCCCAAAGGTCTTGTAT
ABCC2 TACCAATCCAAGCCTCTACC 00000370449 104 bp
AGAATAGGGACAGGAACCAG
ABCG2 TTCGGCTTGCAACAACTATG 00000237612 128 bp
TCCAGACACACCACGGATAA
LRP TGAGGAGGTTCTGGATTTGG 00000357402 135 bp
TGCACTGTTACCAGCCACTC
GADPH GAAGGTGAAGGTCGGAGTCA 00000229239 199 bp
GACAAGCTTCCCGTTCTCAG
β-actin TCTGGCACCACACCTTCTAC 00000331789 169 bp
GATAGCACAGCCTGGATAGC
HRPT1 CTGAGGATTTGGAAAGGGTG 00000298556 156 bp
AATCCAGCAGGTCAGCAAAG
β2M CGCTACTCTCTCTTTCTGGC 00000558401 133 bp
ATGTCGGATGGATGAAACCC