Skip to main content

Table 2 Primers used in the expression analyses of Bos taurus genes by PCR and RT-qPCR

From: Differential regulation of Janus kinase 3 (JAK3) in bovine preovulatory follicles and identification of JAK3 interacting proteins in granulosa cells

Gene   Primer sequence (5′–3′)a Accesion no. AS (bp)
GAPDH Fwd tgttccagtatgattccacccacg NM_001034034 703
Rv ggttgtctcctgcgacttcaacag   
INHBA Fwd gctcatccctctcctttcact NM_174363 171
Rv cgatcatgttctggatgtcct   
LEPROTL1 Fwd tactggcccctctttgttctg NM_001037462 207
Rv caagctccccactcgatcaaa   
CDKN1B Fwd tgtcaaacgtgcgagtgtcta NM_001100346 150
Rv ctctgcagtgcttctccaagt   
JAK3 Fwd gcacctccaagtgaggagac XM_010806603 729
Rv cctctcgaggtccatgatgt   
  1. Abbreviations: AS amplicon size (base pairs), Fwd forward primer, Rv, reverse primer
  2. aAll primers were designed and validated by the authors. Each primer was used at a final concentration of 600 nM