Skip to main content

Table 1 Primer sequences, forward (F) or reverse (R), used for quantitative RT-PCR

From: Macrophage colony-stimulating factor (M-CSF) is an intermediate in the process of luteinizing hormone-induced decrease in natriuretic peptide receptor 2 (NPR2) and resumption of oocyte meiosis

Gene F or R Primer sequence
NPPC F GGGAGCCAATCTCAAGGGAG
  R GTTGCCGCCTTTGTATTTGC
NPR2 F GCATTGTCACCGAGTATTGTCC
  R CAGACCGTAATCTGTTATTTTGAGC
M-CSF F TGATTGGGAATGGACACCTG
  R AAAGGCAATCTGGCATGAAGT
M-CSF-R F GGTGGCTGTGAAGATGCTAAAG
  R AGGCTCCCAAGAGGTTGACTAT
Rpl19 F CCGCTGCGGGAAAAAGAAG
  R CAGCCCATCCTTGATCAGCTT