Skip to main content

Advertisement

Table 1 Details of primers used for various experiments

From: Gonadotropin and steroid hormones regulate pluripotent very small embryonic-like stem cells in adult mouse uterine endometrium

Gene Names Primer Sequence Annealing Temp (°C) Amplicon Size (bp)
Pcna F:GATGCCGTCGGGTGAATTTG
R:TCTCTATGGTTACCGCCTCCT
55 182
Oct-4 F:CCTGGGCGTTCTCTTTGGAAAGGTG
R: GCCTGCACCAGGGTCTCCGA
62 177
Oct-4A F: CCATGTCCGCCCGCATACGA
R: GGGCTTTCATGTCCTGGGACTCCT
60 190
Nanog F: CAGGAGTTTGAGGGTAGCTC
R: CGGTTCATCATGGTACAGTC
61 223
Sox-2 F:GGGGGAAAGTAGTTTGCTGCCTCT
R:TGCCGCCGCCGATGATTGTT
61 135
FSHR1 F:CATTCACTGCCCACAACTTTCATC
R:TGAGTGTGTAATTGGAACCATTGGT
65 256
FSHR3 F:TCTCCACTGCTGCACTGTTGGGCT
R:ATTCAAATACAGGAAATAGAGAAA
56 111
Sca-1 F:AGAGGAAGTTTTATCTGTGCAGCCC
R:TCCACAATAACTGCTGCCTCCTGA
58 223
Stella F:ACGCTTTGGATGATACAGACGTCC
R:GCGCTTTGAACTTCCCTCCGGA
59 175
Fragallis F:GGGGTGACTGAGCTGGGGGAA
R:TGTCCCTAGACTTCACAGAGTAGGC
61 178
ER F:CCTTCTAGACCCTTCAGTCAAGC
R:CGAGACCAATCATCAGAATCTCC
65 155
PR F: CCAGCTCACAGCGCTTCTACC
R: GAAAGAGGAGCGGCTTCACC
62 198
18S F:GGAGAGGGAGCCTGAGAAAC
R: CCTCCAATGGATCCTCGTTA
60 171