Skip to main content

Advertisement

Table 1 Details of primers used for various experiments

From: Gonadotropin and steroid hormones regulate pluripotent very small embryonic-like stem cells in adult mouse uterine endometrium

Gene Names Primer Sequence Annealing Temp (°C) Amplicon Size (bp)
Pcna F:GATGCCGTCGGGTGAATTTG R:TCTCTATGGTTACCGCCTCCT 55 182
Oct-4 F:CCTGGGCGTTCTCTTTGGAAAGGTG R: GCCTGCACCAGGGTCTCCGA 62 177
Oct-4A F: CCATGTCCGCCCGCATACGA R: GGGCTTTCATGTCCTGGGACTCCT 60 190
Nanog F: CAGGAGTTTGAGGGTAGCTC R: CGGTTCATCATGGTACAGTC 61 223
Sox-2 F:GGGGGAAAGTAGTTTGCTGCCTCT R:TGCCGCCGCCGATGATTGTT 61 135
FSHR1 F:CATTCACTGCCCACAACTTTCATC R:TGAGTGTGTAATTGGAACCATTGGT 65 256
FSHR3 F:TCTCCACTGCTGCACTGTTGGGCT R:ATTCAAATACAGGAAATAGAGAAA 56 111
Sca-1 F:AGAGGAAGTTTTATCTGTGCAGCCC R:TCCACAATAACTGCTGCCTCCTGA 58 223
Stella F:ACGCTTTGGATGATACAGACGTCC R:GCGCTTTGAACTTCCCTCCGGA 59 175
Fragallis F:GGGGTGACTGAGCTGGGGGAA R:TGTCCCTAGACTTCACAGAGTAGGC 61 178
ER F:CCTTCTAGACCCTTCAGTCAAGC R:CGAGACCAATCATCAGAATCTCC 65 155
PR F: CCAGCTCACAGCGCTTCTACC R: GAAAGAGGAGCGGCTTCACC 62 198
18S F:GGAGAGGGAGCCTGAGAAAC R: CCTCCAATGGATCCTCGTTA 60 171