Skip to main content

Table 1 Primers sequences

From: HAS2-AS1 is a novel LH/hCG target gene regulating HAS2 expression and enhancing cumulus cells migration

Organism Gene Primer sequence Accession number
Homo sapiens β-Actin (ACTB) sense, 5′ - TTGCCGACAGGATGCAGAA NM_001101.3
antisense, 5′ - GCTCAGGAGGAGCAATGATCTT
HAS2 sense, 5′ – AGCCTTCAGAGCACTGGGACGA NM_005328.3
antisense, 5′ - ACAGATGAGGCTGGGTCAAGCA
HAS2-AS1 sense, 5′ – AGGGGTGGACTTCTTTGGAAC NR_002835.2
antisense, 5′ - CCAAACAGCTCCTTGTGCG