Skip to main content

Advertisement

Table 3 Oligonucleotide primers used for real-time PCR amplification of cDNA obtained after reverse transcription from adolescent human ovary RNA

From: The ovarian germinal reserve and apoptosis-related proteins in the infant and adolescent human ovary

GENE PRIMERS (5′ → 3′) F: forward. R: reverse AMPLIFIED PRODUCT (bp)
BAX (NM_138761.3)* F: GCATCGGGGACGAACTGG R: GTCCCAAAGTAGGAGAGGA 307
BCL2 (NM_000633.2) F: GCCTTCTTTGAGTTCGG R: GGGTGATGCAAGCTCC 250
BID (NM_197966.2) F: CCTTGCTCCGTGATGTCTTTC R: TCCGTTCAGTCCATCCCATTT 100
MCL-1 L (NM_021960.4) F: TAAGGACAAAACGGGACTGG R: ACCAGCTCCTACTCCAGCAA 137
MCL-1S (NM_182763.2) F: GAGACGGCCTTCCAAGGA R: ACCAGCTCCTACTCCAGCAA 112
BCL-XL (NM_138578.1) F:GCAGGTATTGGTGAGTCGGATCGC R: CACAAAAGTATCCCAGCCGCCG 100
FAS (NM_000043.4) F: CACTATTGCTGGAGTCAG R: CTGAGTCACTAGTAATGTCC 266
FAS-L (NM_000639.1) F: TCAATGAAACTGGGCTGTACTTT R: AGAGTTCCTCATGTAGACCTTGT 101
CASPASE-3 (NM_004346.3) F: CCTCTTCCCCCATTCTCAT R: GAGTCCATTGATTCGCTTCC 119
VASA (NM_024415.2) F: AGAAAGTAGTGATACTCAAGGACCAA R: TGACAGAGATTAGCTTCTTCAAAAGT 199
OCT3/4 A (NM_002701.3) F: CTCCTGGAGGGCCAGGAATC R: CCACATCGGCCTGTGTATAT 341
OCT3/4 B (NM_203289.4) F: ATGCATGAGTCAGTGAACAG R: CCACATCGGCCTGTGTATAT 263
Β-actin (NM_001101.3) F: CTTCCCCTCCATCGTGGG R: GTGGTACGGCCAGAGGCG 357