Skip to main content

Advertisement

Table 3 Oligonucleotide primers used for real-time PCR amplification of cDNA obtained after reverse transcription from adolescent human ovary RNA

From: The ovarian germinal reserve and apoptosis-related proteins in the infant and adolescent human ovary

GENE PRIMERS (5′ → 3′)
F: forward. R: reverse
AMPLIFIED
PRODUCT (bp)
BAX (NM_138761.3)* F: GCATCGGGGACGAACTGG
R: GTCCCAAAGTAGGAGAGGA
307
BCL2 (NM_000633.2) F: GCCTTCTTTGAGTTCGG
R: GGGTGATGCAAGCTCC
250
BID (NM_197966.2) F: CCTTGCTCCGTGATGTCTTTC
R: TCCGTTCAGTCCATCCCATTT
100
MCL-1 L (NM_021960.4) F: TAAGGACAAAACGGGACTGG
R: ACCAGCTCCTACTCCAGCAA
137
MCL-1S (NM_182763.2) F: GAGACGGCCTTCCAAGGA
R: ACCAGCTCCTACTCCAGCAA
112
BCL-XL (NM_138578.1) F:GCAGGTATTGGTGAGTCGGATCGC
R: CACAAAAGTATCCCAGCCGCCG
100
FAS (NM_000043.4) F: CACTATTGCTGGAGTCAG
R: CTGAGTCACTAGTAATGTCC
266
FAS-L (NM_000639.1) F: TCAATGAAACTGGGCTGTACTTT
R: AGAGTTCCTCATGTAGACCTTGT
101
CASPASE-3 (NM_004346.3) F: CCTCTTCCCCCATTCTCAT
R: GAGTCCATTGATTCGCTTCC
119
VASA (NM_024415.2) F: AGAAAGTAGTGATACTCAAGGACCAA R: TGACAGAGATTAGCTTCTTCAAAAGT 199
OCT3/4 A (NM_002701.3) F: CTCCTGGAGGGCCAGGAATC
R: CCACATCGGCCTGTGTATAT
341
OCT3/4 B (NM_203289.4) F: ATGCATGAGTCAGTGAACAG
R: CCACATCGGCCTGTGTATAT
263
Β-actin (NM_001101.3) F: CTTCCCCTCCATCGTGGG
R: GTGGTACGGCCAGAGGCG
357