Skip to main content

Advertisement

Table 2 Primer sequences

From: Involvement of epigenetic modification of TERT promoter in response to all-trans retinoic acid in ovarian cancer cell lines

Assay Primers Localization PCR size
TERT expression TERT-Fwd TERT-Rev TGACACCTCACCTCACCCAC CACTGTCTTCCGCAAGTTCAC Exon 10 Exon 11 95 bp
GAPDH expression GAPDH-Fwd GAPDH-Rev AAGGTGAAGGTCGGAGTCAAC GAGTTAAAAGCAGCCCTGGTG Exon 2 Exon 3 68 bp
TERT methylation TERT-pyr-Fwd TERT-pyr-Rev TERT-pyr-Seq GGGGTTTTAGTTGGAGTTTTTGTA ATCCACTAAAAACCCTACCTAACC GTTTTTGTATTTTGGGAG Promoter 127 bp