Skip to main content

Table 1 List of primer sequences for real time PCR

From: Anti-proliferative effects of mesenchymal stem cells (MSCs) derived from multiple sources on ovarian cancer cell lines: an in-vitro experimental study

PrimersForwardReverse
CA-1255′-GCACAATTCCCCCAACCTCC−3′5′-TGCCTCTGGATGGAGGTCTAA−3′
MMP-25′- AGCTGGCCTAGTGATGATGTT −3′5′- TTCAGCACAAACAGGTTGCAG−3′
MMP-95′-CGCAGACATCGTCATCCAGT−3′5′-GAAATGGGCGTCTCCCTGAA−3′
TIMP-15′GACCAAGATGTATAAAGGGTTCCAA−3′5′GAAGTATCCGCAGACACTCTCCAT−3′
TIMP-25′-AGGCGTTTTGCAATGCAGAT−3′5′TCCAGAGTCCACTTCCTTCTCACT−3′
TIMP-35′-CAGGACGCCTTCTGCAACTC−3′5′-AGCTTCTTCCCCACCACCTT−3′
GAPDH5′-GCACCACCAACTGCTTAGCA−3′5′-CTTCCACGATACCAAAGTTGTCAT−3′