Skip to main content

Table 1 Forward and reverse primers used for qPCR

From: Differences in immune-related gene expressions and tumor-infiltrating lymphocytes according to chemotherapeutic response in ovarian high-grade serous carcinoma

Gene Forward primer Reverse primer
CCL5 AGTGCTCCAACCCAGCAG GGGAAGCCTCCCAAGCTA
CD38 GGATGCTTTCAAGGGTGC GCCTAGCAGCGTGTCCTC
IRF1 AGGCCAACTTTCGCTGTG GCTGGAATCCCCACATGA
CXCL9 GCCACCGAGATCCTTATCG CCACATCCTGCAGAGGCT
PSMB9 CTGGGACCAACGTGAAGG ATGGCCAGAGCAATAGCG
LTB GGGTTTCAGAAGCTGCCA CGGTAGCCGACGAGACAG
GZMA CAGTTGTCGTTTCTCTCCTGC TGAGCCCCAAGAATGACC
VCAM1 AAAACAATGAGCTGAGAGGCA TCAAGGAACTCCTCCAGTTCTC
CD24 GCACCCAGCATCCTGCTA GCCTTGGTGGTGGCATTA
IL-8 TCCATAAGGCACAAACTTTCA CCTTGGCAAAACTGCACC
CD164 TTGGGGAAAGGTCGGTTT CATGAATGTGTGTCAGGGAA