Skip to main content

Table 1 Primers for RT-PCR

From: Effects of activating GABAB1 receptor on proliferation, migration, invasion and epithelial-mesenchymal transition of ovarian cancer cells

Gene Primer (5′-3′) Length of primer (bp) Length of product (bp)
E-cadherin For: CTCACATTTCCCAACTCCTCT 21 234
Rev: TGTCACCTTCAGCCATCCT 19
N-cadherin For: GCTTATCCTTGTGCTGATGTTT 22 142
Rev: GTCTTCTTCTCCTCCACCTTCT 22
GABAB1 For: GTGAATAGCCGCAGGGACA 19 215
Rev: CTGGAGCCATAGGAAAGCA 19
GAPDH For: GAAGGTCGGAGTCAACGGAT 20 224
Rev: CCTGGAAGATGGTGATGGG 19