Skip to main content

Table 1 Sequences of the Primers Used in Real-Time PCR

From: Decreased ovarian function and autophagy gene methylation in aging rats

GeneForward primerReverse primer
Atg5CACTGGGACTTCTGCTCCTGTTCTTCAACCAAGCCAAACC
Atg12AAACGAAGAAATGGGCTGTGGAAGGGGCAAAGGACTGATT
Atg16LCTGTGCTTTTCCCGTCTTTCGCCCTGATTTGGTTTCCAC
Lc3BGGTGTTTTTCTCCTGGTTTGGGCACTTGGACTTCAGCCTTC
Beclin1GCCTCTGAAACTGGACACGCCTCTTCCTCCTGGCTCTCT
Dnmt1CGACGACGCTAAGGACGATGATGGCCTTGTTGCTCGCCTCTGTC
Dnmt2GCGGTTGCGAGAGGATGGAACACGTCAATAGCAGCCACCACATG
Dnmt3BAGACCAGAGGCCGCAGATCAAGTCCGCTTCACCATCTCCATCTCC
Dnmt3ATGCCAGTCATCCGCCACCTCCTCCGTCCTCTCGTTCTTGGTG