Skip to main content

Table 1 Primer sequences for qPCR

From: Knockdown of circ-FURIN suppresses the proliferation and induces apoptosis of granular cells in polycystic ovary syndrome via miR-195-5p/BCL2 axis

Name Forward (5′-3′) Reverse (5′-3′)
Circ-FURIN CGTGCAGACTATGCAAACCAG TTCTCGGTGCTATAGTGCGT
AVEN GACTTCAGTGTCCTCTTGAG CCTTGCCATCATCGTTTCTC
BCL2 GGAAGGTAGTGTGTGTGG ACTCCACTCTCTGGGTTCTTGG
XIAP GACAGTATGCAAGATGAGTCAAGTCA GCAAAGCTTCTCCTCTTGCAG
AREL1 GAGGGGACCGGACTATTTATGA TCCTTCCAATCCCAGGAGACT
miR-195-5p CGCAGCACAGAAATATTGGC CTCAACTGGTGTCGTGGAGTC
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG
U6 GCTTCGGCAGCACATATACTAAAAT GCTTCGGCAGCACATATACTAAAAT