Skip to main content

Table 1 qRT-PCR relatively primer sequences

From: Biological and prognostic value of ETV5 in high-grade serous ovarian cancer

Genes forward primer(5′-3′) reverse primer(5′-3′)
ETV5 CAGCACACGGGTTCCAGTCAC TGGCAGTTAGGCACTTCTGAATCG
GAPDH GAGTCAACGGATTTGGTCGT TTGATTTTGGAGGGATCTCG