Skip to main content

Table 3 Primer sequences used for RT-qPCR

From: LncRNA MNX1-AS1 promotes ovarian cancer process via targeting the miR-744-5p/SOX12 axis

Genes Primer sequences (5′-3′)
MNX1-AS1
 Forward CACCAACGGGGAGTGGATAC
 Reverse CTCCAGGGACCAACCAAGTC
miR-744-5p
 Forward GTGCGGGGCTAGGGCTA
 Reverse AGTGCAGGGTCCGAGGTATT
SOX12
 Forward CTGGAGTGGTGGGATTGGTC
 Reverse GGGTGTCAGAGGGACAAAGG
U6
 Forward CTCGCTTCGGCAGCACA
 Reverse AACGCTTCACGAATTTGCGT
GAPDH
 Forward AGTCCACTGGCGTCTTCA
 Reverse GAGTCCTTCCACGATACCAA