Skip to main content

Table 1 The primer sequences for qRT-PCR in this study

From: Curcumin inhibits ovarian cancer progression by regulating circ-PLEKHM3/miR-320a/SMG1 axis

Name Sequence (5′-3′)
Forward Reverse
circ-PLEKHM3 GGAAGAACAAACGCCAATCT TTTGGGAATGTCTGCTTGTG
miR-320a GCCGAGAAAAGCTGGGTTGAGA CTCAACTGGTGTCGTGGA
SMG1 GGAAGGTAATGAGCCGCAGA TCAGTTCTGGGTTGCCAGTC
GAPDH AGCCACATCGCTCAGACAC GCCCAATACGACCAAATCC
U6 CTCGCTTCGGCAGCACATA CGAATTTGCGTGTCATCCT