Skip to main content

Table 1 Primer sequences for RT-qPCR

From: RNA-binding protein IGF2BP2 enhances circ_0000745 abundancy and promotes aggressiveness and stemness of ovarian cancer cells via the microRNA-3187-3p/ERBB4/PI3K/AKT axis

Gene Primer sequence (5′-3′)
circ_0000745 F: ATGTTGAAAGTAGCCCGAGCAG
R: TGGGAGTGTTGGAAGAAGTTGG
SPECC1 F: ACCCCAGGAAATCAGTGTCCA
R: GTTCCCGAACTTGGGACTCAA
miR-3187-3p F: CCTGGGCAGCGTGTGGCT
R: CTCAACTGGTGTCGTGGA
ERBB4 F: GGAGTATGTCCACGAGCACAAG
R: CGAGTCGTCTTTCTTCCAGGTAC
IGF2BP2 F: GTTGGTGCCATCATCGGAAAGG
R: TGGATGGTGACAGGCTTCTCTG
GAPDH F: GGGAAACTGTGGCGTGAT
R: GAGTGGGTGTCGCTGTTGA
U6 F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
  1. Note: RT-qPCR Reverse transcription quantitative polymerase chain reaction, SPECC1 Sperm antigen with calponin homology and coiled-coil domains 1, miR microRNA, ERBB4 Erb-b2 receptor tyrosine kinase 4, IGF2BP2, insulin like growth factor 2 mRNA binding protein 2, GAPDH Glyceraldehyde-3-phosphate dehydrogenase, F Forward, R Reverse