Skip to main content

Table 1 The primers for qRT-PCR

From: Investigation of the mechanisms and experimental verification of Cuscuta-Salvia in the treatment of polycystic ovary syndrome (PCOS) via network pharmacology

ID Sequence (5′-3′) Product Length (bp)
β-actin
β-actin
F: TGTGATGGTGGGAATGGGTCAGAA
R: TGTGGTGCCAGATCTTCTCCATGT
140
IL6
IL6
F: CCAAGAGGTGAGTGCTTCCC
R: CTGTTGTTCAGACTCTCTCCCT
118
Akt1
Akt1
F: ATGAACGACGTAGCCATTGTG
R: TTGTAGCCAATAAAGGTGCCAT
116
TP53
TP53
F: GCGTAAACGCTTCGAGATGTT
R: TTTTTATGGCGGGAAGTAGACTG
144
MAPK1
MAPK1
F: CCCAAGTGATGAGCCCATTG
R: TCAATGGAAGGGGACAAACTGA
248
JUN
JUN
F: TCGCTCGGCTAGAGGAAAAA
R: CTGCTGCGTTAGCATGAGTT
152
EGF
EGF
F: AGGAGGTCCGCTAGAGAAATG
R: CAGGCGATGAACAACCAGTG
279
CYP17a1
CYP17a1
F: CTCCAGCCTGACAGACATTC
R: CTGAGAACACACTTGGGTCC
89
CYP19a1
CYP19a1
F: GGGGACAGTATGCTGGCTAA
R: GCCCAGCTTCTCCCTGTAAA
282
AR
AR
F: CGAAGTGTGGTATCCTGGTG
R: CTGGTACTGTCCAAACGCAT
132
FSHb
FSHb
F: CTGGTGCTGGAGAGCAATCT
R: ACTTTCTGGGTATTGGGCCG
174
LHb
LHb
F: AACTCCCAAGCATCAGCCTC
R: AGATGTGGAGGTGGCTAGAG
171