Figure 2From: Attributes of Oct4 in stem cell biology: perspectives on cancer stem cells of the ovary mRNA expression of OCT4A in isolated cells obtained from chemonaive and chemoresistant ovarian cancer patients. Ascites cells were isolated as described previously [10]. RNA extractions, cDNA synthesis and quantitative determination of mRNA levels of Oct4A were performed as previously described [99]. Sense and antisense primers were designed against published human sequences for Oct4A (Entrez Gene ID 5460, approved symbol POU5F1): forward- CTCCTGGAGGGCCAGGAATC; reverse- CCACATCGGCCTGTGTATAT; 18S (Entrez Gene ID 100008588, approved symbol RN18S1) forward-GTAACCCGTTGAACCCCATT; reverse-CCATCCAATCGGTAGTAGCG. Gel extraction of PCR products was performed using the QiaEX II Agarose gel extraction Kit (Qiagen Australia), as per the manufacturers’ protocol and quantified using the ND-1000 Nanodrop spectrophotometer (NanoDrop Technologies Inc Wilmington, DE, USA). Sequences and products were verified as described previously [99]. Results are expressed as the difference between the log2 transformed ΔCt values of the gene of interest to that of housekeeping gene (18S) ±SEM of five independent samples performed in triplicate. *P<0.05, significantly different in recurrent versus chemonaive ascites samples.Back to article page