Skip to main content

Table 2 List of primer details and PCR cycling conditions used in the study

From: Stimulation of ovarian stem cells by follicle stimulating hormone and basic fibroblast growth factor during cortical tissue culture

Gene Primer sequence Annealing temperature (°C) Amplicon size (bp)
Pluripotent markers (Human)
Oct-4A F: AGCCCTCATTTCACCAGGCC 57°C 448
  R: TGGGACTCCTCCGGGTTTTG   
Nanog F: TGCAAATGTCTTCTGCTGAGAT 57°C 285
  R: GTTCAGGATGTTGGAGAGTTC   
Early germ cell markers (Human)
Oct-4 F: GAAGGTATTCAGCCAAACGAC 55°C 315
  R: GTTACAGAACCACACTCGGA   
Oct-4 (marmoset) F: CCCCTGGTGCTGTGAAGCTGG 64°C 124
  R: CCCCAGGGTGAGCCCCACAT   
c-Kit F: CCTGGGATTTTCTCTGCGTT 60°C 376
  R: ATTGGTCACTTCTGGGTCTG   
Vasa F: GAC TGC GGC TTT TCT CCT ACC 55°C 418
  R: TTT GGC GCT GTT CCT TTG AT   
PF transition markers (Human)
Amh F: CACCTGGAGGAAGTGACCTG 60°C 202
  R: CCACCGCTAACACCAGGTAG   
Amh (marmoset) F: ACCTGGAGGAAGTGACATGG 64°C 190
  R: ACCAGGTAGTGGGTGTCTCG   
Gdf-9 F: CTCCTGGAGACCAGGTAACAGGAAT 65°C 291
  R: TGCACACACATTTGACAGCAGAGG   
Lhx8 F: CAAGCACAATTTGCTCAGGA 62°C 230
  R: GGCACGTAGGCAGAATAAGC   
Housekeeping gene (Human)
18S F: GGAGAGGGAGCCTGAGAAAC 60°C 171
  R: CCTCCAATGGATCCTCGTTA   
  1. Amh (granulosa cells), Gdf-9 and Lhx8 (oocyte specific).