Skip to main content

Table 2 Primers used for constructs and detection of the expression of miR-124.

From: MiR-124 inhibits the migration and invasion of ovarian cancer cells by targeting SphK1

Name Sequence (5’-3’) Tm (°C) Amplicon (bp)
Sphk1-UTR-F ACGCTCGAGGAATTGATGGTTAGCGAGGCC 64.5 1155
Sphk1-UTR-R AGGGCGGCCGCTTATTTGGATTTGGTTCGTGGG 65
Sphk1-UTR-Mut-site-F GACCCCTGGGCCGCGCTGTCCGTAAGTGTCTACTTGCAGGACC 85 6658
Sphk1-UTR-Mut-site-R GGTCCTGCAAGTAGACACTTACGGACAGCGCGGCCCAGGGGTC 84
U6-F CGCTTCGGCAGCACATATAC 59.4 64
U6-R CAGGGGCCATGCTAATCTT 57.5
MiR-124-F GATACTCATAAGGCACGCGG 60.6 60
MiR-124-R GTGCAGGGTCCGAGGT 57.9
MiR-124-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCATTCT 87.8