Skip to main content

Table 1 Primer pairs used in the experiment

From: Primordial follicle activation in the ovary of Ames dwarf mice

Gene Primer sequence
β2M For AAGTAT ACT CAC GCC ACC CA
Rev CAG GCGTAT GTATCA GTC TC
GHR For AGGTCTCAGGTATGGATCTTTGTCA
GCCAAGAGTAGCTGGTGTAGCCT
IGF-I For CTGAGCTGGTGGATGCTCTT
Rev CACTCATCCACAATGCCT
SOCS2 For CTG CGC GAG CTC AGT CAA A
Rev ATC CGC AGGTTA GTC GGT CC
SOCS3 For TGT CGG AAG ACT GTC AAC GG
  Rev GAA GAA GCC AAT CTG CCC CT
Akt1 For CCG GTT CTT TGC CAA CAT CG
Rev ACA CACTCC ATG CTG TCA TCT T
Pi3k For TAGCTGCATTGGAGCTCCTT
Rev TACGAACTGTGGGAGCAGAT
mTOR For CGG CAA CTT GAC CAT CCT CT
Rev TGCTGG AAG GCGTCA ATC TT
IRS-1 For CGG GGA AGA CGA GAT GCT TT
Rev TAC TGG AGC CTT GCG GCA C
FOXO3a For TCCCAGATCTACGAGTGGATGG
Rev CCTTCATTCTGAACGCGCAT
BMP15 For GAGCGAAAATGGTGAGGCTG
Rev GGCGAAGAACACTCCGTCC
GDF9 For GCTCTATAAGACGTATGCTACC
Rev CAGAGTGTATAGCAAGACCGAT
AMH For TCCTACATCTGGCTGAAGTGATATG
Rev CAGGTGGAGGCTCTTGGAACT