Skip to main content

Table 2 Primers used for the present study

From: Histological analysis of arteriovenous anastomosis-like vessels established in the corpus luteum of cows during luteolysis

Gene name Accession no. Forward Reverse Product size
Gapdh BC102589 caccctcaagattgtcagca ggtcataagtccctccacga 103
Acta2 NM_001034502 gccgagatctcaccgactac gtgatcacctgcccatcag 202
Tgfb1 NM_001166068 ccttcctgctcctcatgg ggttgtgctggttgtacagg 276