Skip to main content

Table 1 Sequences of primers used in qRT-PCR

From: Short‐term rapamycin administration elevated testosterone levels and exacerbated reproductive disorder in dehydroepiandrosterone‐induced polycystic ovary syndrome mice

  Forward primer Reverse primer
Cyp11a1 GTACCCTGGTGTCCTTTATAGCCTCCT TGTGTGCCATCTCATAAAGGTTCCACT
Cyp17a1 GCTGGCCAGAGAAGTGCTCGT CTTGGTCCGACAAGAGGCCTAGAG
Hsd3b1 CTGTTGTCATCCACACTGCTGCTG TGCTTGAACACAGGCCTCCAATAG
Cyp19a1 CAGCCCCTGACACCATGTCG ACAGGCTGGTACCGCATGCTT
Fshr TTTTCCAGGGAGCCTCTGGGC AAGCCATGGTTGGGCAGGGAA
Lhr CCTCCAGAGAAAAATTCACCAGCCTACT TCGCTTCTCTAACTGTGCTTTCACATTG
Gapdh AATGGATTTGGACGCATTGGT TTTGCACTGGTACGTGTTGAT