Skip to main content

Table 1 qRT-RCR primer sequences

From: Long-term intermittent cold exposure affects peri-ovarian adipose tissue and ovarian microenvironment in rats

Name Primer sequences
FST 5′-CAGCGACAATGCCACGTA-3’
5′-TGCACACTGCTGGACAGTTTA-3’
Lep 5′-CGAGACCTCCTCCATCTGCT-3’
5′-CTGCTCAAAGCCTCCACCTC-3’
ADPN 5′-CTGGGCATCTCTGCCATCA-3’
5′-CTTGACAAAGCCCTCAGCGATA-3’
AMPK 5′-TGAGCTTACAGCTTTACCTGGTTG-3’
5′-CACTTGACCGAGGTCTGTGGA-3’
UCP-1 5′-GTACCCAGCTGTGCAATGAC-3’
5′-GATGACGTTCCAGGATCCGA-3’
PGC-1α 5′-GCACTGACAGATGGAGACGTGA-3’
5′-TCATTGTAGCTGAGCTGAGTGTTGG-3’
PRDM16 5′-ACAAAGGGAAGCCAGCAGAG-3’
5′-GAGGCGGGAAGAAGGAATG-3’
Dpt 5′-AGGGCTCTGACAGACAGTGGAACTA-3’
5′-ACTGACTCGAAGTAACGGCTTTGG-3’
HOXC9 5′-CGGCAGCAAGCACAAAGAG-3’
5′-ACCGACGGTCCCTAGTTAAATACA-3’
Fndc5 5′-ATCATCGTCGTGGTCCTCTTC-3’
5′-TGGTCTCTGATGCACTCTTGG-3’
MST 5′-CGCTACCACGGAAACAATCATT-3’
5′-GCTTTCCATCCGCTTGCA T-3’
cyb11a1 5′-AGAAGCTGGGCAACATGGAGT-3’
5′-TCACATCCCAGGCAGCTGCATGGT-3’
cyp19a1 5′-TAAAAGATGGCACACAAAGAGTGC-3’
5′-ACCGAGGTTACCTGGATCTGC-3’
β-actin 5′- CCTAAGGCCAACCGTGAAAA −3’
5′- CAGAGGCATACAGGGACAACAC − 3’